Sequence ID | >WENV180098988 |
Genome ID | MTBK01280380 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 574 |
End posion on genome | 656 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttatctccaa |
tRNA gene sequence |
GGGGAAATGCTGGAATTGGCAGACAGGCATGACTTAGGATCATGTGCGGCAACGCGTGAG |
Downstream region at tRNA end position |
catttattta |
Secondary structure (Cloverleaf model) | >WENV180098988 Leu TAG a ACag catttattta G - C G - C G - C G - C A - T A - T A - T C G T C T C T C A T A A G | | | | | G T G G T C G A G A G C G | | | T T G A C A G C A G G TGCGGCAACGCGT C - G A - T T - A G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |