Sequence ID | >WENV180098993 |
Genome ID | MTBK01280727 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 25143 |
End posion on genome | 25228 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
acatcatgat |
tRNA gene sequence |
GGAGGGATGGCCGAGTGGTCTATGGCGGCGGTCTTGAAAACCGTTGACCGAAAGGTTCGC |
Downstream region at tRNA end position |
gatcaaacag |
Secondary structure (Cloverleaf model) | >WENV180098993 Ser TGA t GCCA gatcaaacag G - C G - C A - T G - C G - C G - C A - T T A T C G T C C A T G A G | | + | | G G G C C G G C G G G C G + | | | T T T T G G C C T A G TGACCGAAAGGTTC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |