Sequence ID | >WENV180098994 |
Genome ID | MTBK01280727 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 25295 |
End posion on genome | 25389 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aaaaatcagc |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGCCGAAAGCGATCGCCTGCTAAGCGATTGTACGCCCTTCAAAG |
Downstream region at tRNA end position |
ttttttattc |
Secondary structure (Cloverleaf model) | >WENV180098994 Ser GCT c GCCA ttttttattc G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A T G A G | | | | | A G G T C G G C G G G C G | | | T T C A A G C C G A G TGTACGCCCTTCAAAGGTGTACC A - T T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |