Sequence ID | >WENV180099026 |
Genome ID | MTBK01282695 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11900 |
End posion on genome | 11974 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
attttttttt |
tRNA gene sequence |
GGGCGAATAGCTCAGTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCGTAGGTTCAAATC |
Downstream region at tRNA end position |
cttcaaggtg |
Secondary structure (Cloverleaf model) | >WENV180099026 Val TAC t ACCA cttcaaggtg G - C G - C G - C C - G G - C A - T A - T T A T C G T C C A G A A | + | | | A T C T C G G T A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |