Sequence ID | >WENV180099043 |
Genome ID | MTBK01283787 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 304 |
End posion on genome | 209 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
gtagatcgac |
tRNA gene sequence |
GGAAGGGCAACCATCCTGGTGGGTGGGCCGGGCTTCAAACCCGGTGGGTGGCGCCAAGCG |
Downstream region at tRNA end position |
gtcccgcgcc |
Secondary structure (Cloverleaf model) | >WENV180099043 SeC TCA c GCCA gtcccgcgcc G - C G - C A - T A - T G - C G - C G - C C - G T C A T A C C C A T C C A + | | | | G G T A C C G T G G G C G + | | | T T T G T G G G G G TGGGTGGCGCCAAGCGCCGCCGG C - G C - G G - C G - C G - C C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |