Sequence ID | >WENV180099049 |
Genome ID | MTBK01284039 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 691 |
End posion on genome | 778 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tcatagagcT |
tRNA gene sequence |
GGAGAGGTGCCCGAGTGGCCGAAGGGGGTTGCCTGCTAAGCAATTGTATCGTTTAGGTAC |
Downstream region at tRNA end position |
gagttaaaat |
Secondary structure (Cloverleaf model) | >WENV180099049 Ser GCT T GAat gagttaaaat G - C G - C A - T G - C A - T G + T G - C T A T C C C C C A T G A G | | | | | G G G C C C G G G G G C G | | | T T C A G G G C G A G TGTATCGTTTAGGTACC G + T T - A T - A G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |