Sequence ID | >WENV180099073 |
Genome ID | MTBK01285750 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 234 |
End posion on genome | 320 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gttcttgagt |
tRNA gene sequence |
GCGGTCGTGGCGGAACTGGTAGACGCGCAACGTTGAGGTCGTTGTGGGCGAAAGCCCGTG |
Downstream region at tRNA end position |
attcttcccc |
Secondary structure (Cloverleaf model) | >WENV180099073 Leu GAG t ACCA attcttcccc G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A C A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGCGAAAGCCCGT C - G A - T A - T C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |