Sequence ID | >WENV180099076 |
Genome ID | MTBK01285848 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 398 |
End posion on genome | 482 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tttttactaa |
tRNA gene sequence |
GCGCAGGTGTTGAAACTGGTAGACAAGCATCCTTGAGGTGGATGTGCTCTCACGAGCATG |
Downstream region at tRNA end position |
aagcgaagct |
Secondary structure (Cloverleaf model) | >WENV180099076 Leu GAG a ACaa aagcgaagct G - C C - G G - C C - G A - T G - C G - C T G T T C T C C A C A A G + | | | | A T A G T T G G A G G C G | | | T T G A C A A T A G G TGCTCTCACGAGCAT C - G A - T T - A C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |