Sequence ID | >WENV180099083 |
Genome ID | MTBK01286687 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 940 |
End posion on genome | 1015 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tagattcatt |
tRNA gene sequence |
TGACCTATAGCAAAGTTGGTAATGCGCCGGACTGCAAATCCGATATGCGTGAGTTCGAGT |
Downstream region at tRNA end position |
cttattttca |
Secondary structure (Cloverleaf model) | >WENV180099083 Cys GCA t TCCA cttattttca T - A G - C A - T C - G C - G T - A A - T T G T C A C T C A T G A A | | | | | G T A A C G G T G A G C G | | | T T G A T G C T A G TATGC C A C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |