Sequence ID | >WENV180099094 |
Genome ID | MTBK01287393 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 768 |
End posion on genome | 683 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agttcatttt |
tRNA gene sequence |
GCCGAAGTGGCGGAAATGGTAGACGCAAGGGACTTAAAATCCCTCGATCCTTTGGATCGT |
Downstream region at tRNA end position |
ctttcataat |
Secondary structure (Cloverleaf model) | >WENV180099094 Leu TAA t ACaa ctttcataat G - C C - G C - G G - C A - T A - T G - C T T T C G G C C A A A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G A CGATCCTTTGGATCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |