| Sequence ID | >WENV180131254 |
| Genome ID | OATG01005567 |
| Phylum/Class | [OATG] human gut metagenome; faeces |
| Species | |
| Start position on genome | 76 |
| End posion on genome | 2 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
atcgttccaa |
| tRNA gene sequence |
GCGGATGTAGCTCAGGGGTAGAGCGCAACCTTGCCAAGGTTGATGTCGTGGGTTCGAATC |
| Downstream region at tRNA end position |
annnnnnnnn |
| Secondary structure (Cloverleaf model) | >WENV180131254 Gly GCC
a TCCA annnnnnnnn
G - C
C - G
G - C
G - C
A - T
T - A
G - C T A
T T A C C C A
G A A + | | | | G
G C T C G G T G G G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |