| Sequence ID | >WENV180137861 |
| Genome ID | OATP01000869 |
| Phylum/Class | [OATP] human gut metagenome; faeces |
| Species | |
| Start position on genome | 2350 |
| End posion on genome | 2436 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
tcattattaT |
| tRNA gene sequence |
GCCGGTGTGGCGGAATTGGCAGACGCGCGGGATTCAAAATCCCGTTCCAGCGATGGAGTA |
| Downstream region at tRNA end position |
cggcccccta |
| Secondary structure (Cloverleaf model) | >WENV180137861 Leu CAA
T AGCa cggcccccta
G + T
C - G
C - G
G - C
G - C
T - A
G - C C C
T T A G C C A
T A A G | | | | | G
T G G C G A T C G G C
G | | | T T
G A C G C
C A G G TTCCAGCGATGGAGT
C - G
G - C
G - C
G - C
A - T
T A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |