| Sequence ID | >WENV180287795 |
| Genome ID | OBIL01004373 |
| Phylum/Class | [OBIL] metagenome; hydrothermal vent |
| Species | |
| Start position on genome | 644 |
| End posion on genome | 717 |
| Amino Acid | Ala |
| Anticodon | CGC |
| Upstream region at tRNA start position |
ccaccaatga |
| tRNA gene sequence |
GGGCTCGTAGCTCAGCCTGGCAGAGCGCCGCCTTCGCAAGGCGGAGGCCCCGGGTTCAAA |
| Downstream region at tRNA end position |
ccttttatac |
| Secondary structure (Cloverleaf model) | >WENV180287795 Ala CGC
a Atta ccttttatac
G - C
G - C
G + T
C - G
T - A
C - G
G - C T A
T G G C C C A
C G A A | | | | | A
C C T C G C C G G G C
T | | | | T T
G G A G C
G C A G AGGCC
C - G
C - G
G - C
C - G
C - G
T A
T A
C G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |