| Sequence ID | >WENV180317396 |
| Genome ID | OBKJ01141691 |
| Phylum/Class | [OBKJ] metagenome; hydrothermal vent |
| Species | |
| Start position on genome | 1 |
| End posion on genome | 74 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
nnnnnnnnnn |
| tRNA gene sequence |
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA |
| Downstream region at tRNA end position |
taataattta |
| Secondary structure (Cloverleaf model) | >WENV180317396 Lys TTT
n Gtta taataattta
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T T T C C C A
T G A A + | | | | G
C T T C G G A G G G C
T + | | | T T
G G A G C
G T A G CGGTC
C - G
C - G
T - A
G - C
A - T
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |