The detailed information of tRNA gene sequence


Sequence ID>W141039126
Genome IDALWO02000023
Search identical group
Phylum/ClassBacteroidetes
SpeciesIndibacter alkaliphilus LW1 [ALWO]
Start position on genome 258103
End posion on genome 258027
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
cttagtttta
tRNA gene sequence
GCACTCGTAGTTCAACTGGATAGAATATCGGATTTCGGCTCCGAGGGTTGAGGGTTCGAA
TCCTTCCGAGTGCACAA
Downstream region at tRNA end position
aaagaccacc
Secondary structure (Cloverleaf model)
>W141039126	Arg	TCG
                   a      ACAA aaagaccacc
                     G - C
                     C - G
                     A - T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C T T C C     A
      C A A        A      | | + | |     G
    T       C T T G       G A G G G     C
    G       | | | +                 T T
    G       G A A T
      A T A        A     GGGTT
                    T - A
                    C - G
                    G - C
                    G - C
                    A - T
                  T       C
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK