The detailed information of tRNA gene sequence


Sequence ID>W141066471
Genome IDARPL01000001
Search identical group
Phylum/ClassChloroflexi
SpeciesDehalococcoidia bacterium SCGC AB-539-J10 [ARPL]
Start position on genome 12488
End posion on genome 12564
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
caaactgctt
tRNA gene sequence
GTCCCTGTAGCTCAGTTGGACAGAGCGGCTGCCTTCTAAGCAGCGGGTCGTGGGTTCGAA
TCCCTCCAGGGACGCCA
Downstream region at tRNA end position
gacttggacc
Secondary structure (Cloverleaf model)
>W141066471	Arg	TCT
                   t      GCCA gacttggacc
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     C T C C C     A
      T G A        A      |   | | |     G
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GGGTC
                    G - C
                    C - G
                    T - A
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK