| Sequence ID | >WENV181213573 |
| Genome ID | OFBV01009443 |
| Phylum/Class | [OFBV] metagenome; hydrothermal vent |
| Species | |
| Start position on genome | 653 |
| End posion on genome | 725 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
gacaagatcg |
| tRNA gene sequence |
GGGCTCGTGGTCTAGGGGTTATGACGTCGCCCTTACGAGGCGAAGGTCCCCGGTTCGAAT |
| Downstream region at tRNA end position |
tcacccttct |
| Secondary structure (Cloverleaf model) | >WENV181213573 Val TAC
g Atct tcacccttct
G - C
G - C
G - C
C - G
T - A
C - G
G - C T A
T G G G C C A
G G A G | | | | | G
G T C T G C C C G G C
G | | | T T
T T G A C
T A G AGGTC
T - A
C - G
G - C
C - G
C - G
C A
T G
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |