| Sequence ID | >WENV181324128 |
| Genome ID | OFLC01000219 |
| Phylum/Class | [OFLC] marine metagenome; melt pond |
| Species | |
| Start position on genome | 2784 |
| End posion on genome | 2873 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
gctttcccac |
| tRNA gene sequence |
GGTGACGTGTCCGAGCGGCCGAAGGTGCAACTCTCGAAAAGTTGTGTGGGTGAAAGTCCA |
| Downstream region at tRNA end position |
tgtttgtttg |
| Secondary structure (Cloverleaf model) | >WENV181324128 Ser CGA
c GCCA tgtttgtttg
G - C
G - C
T - A
G - C
A - T
C - G
G - C T A
T C A C C C A
C G A G | | | | | A
G G C C T G T G G G C
G | | T T
C A G G T
C G A G TGTGGGTGAAAGTCCACC
C - G
A - T
A - T
C - G
T - A
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |