The detailed information of tRNA gene sequence


Sequence ID>W141137374
Genome IDAWGX01000906
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesSmithella sp. ME-1 [AWGX]
Start position on genome 2121
End posion on genome 2196
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
attgaaacag
tRNA gene sequence
GCGGGAGTAGCTCAGTGGCTAGAGCGTCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAAT
CCCGTTTCCCGCTCCA
Downstream region at tRNA end position
gaaaaatagg
Secondary structure (Cloverleaf model)
>W141137374	Gly	TCC
                   g      TCCA gaaaaatagg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     G + T          T A
                    T     T G C C C     A
      T G A        A      + | | | |     G
    G       C T C G       G C G G G     C
    G       | | | |                 T T
    C       G A G C
      T A          G     GGGTC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK