The detailed information of tRNA gene sequence


Sequence ID>W141139533
Genome IDAWNS01000053
Search identical group
Phylum/ClassCloacimonetes
SpeciesCloacimonetes bacterium JGI OTU-5 [AWNS]
Start position on genome 8042
End posion on genome 8117
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ataaaatttc
tRNA gene sequence
GGGCCTATAGCTCAGTTGGTAGAGCTTCCGGCTCATAACCGGACGGTCAGAGGTTCGATT
CCTCTTGGGCCCACCA
Downstream region at tRNA end position
gaaactaaaa
Secondary structure (Cloverleaf model)
>W141139533	Met	CAT
                   c      ACCA gaaactaaaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T + G
                     A - T          T T
                    T     T C T C C     A
      T G A        A      | | | | |     G
    T       C T C G       A G A G G     C
    G       | | | |                 T T
    G       G A G C
      T A          T     CGGTC
                    T - A
                    C - G
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK