The detailed information of tRNA gene sequence


Sequence ID>W141139673
Genome IDAWNX01000008
Search identical group
Phylum/ClassCloacimonetes
SpeciesCloacimonetes bacterium JGI OTU-1 [AWNX]
Start position on genome 4729
End posion on genome 4644
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
taattttaat
tRNA gene sequence
GGAGGATTAGTCCTAATTGGTAAGGCAGCGGTCTTGAAAACCGCCGGGCTCTGCCCTTGG
GGGTTCGAGTCCCTCATCCTCCGCCA
Downstream region at tRNA end position
ttttgttctt
Secondary structure (Cloverleaf model)
>W141139673	Ser	TGA
                   t      GCCA ttttgttctt
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C
                     A - T
                     T - A          T G
                    T     C T C C C     A
      A A T        A      | + | | |     G
    T       C C T G       G G G G G     C
    T         | + |                 T T
    G       A G G C
      G T A        A     CGGGCTCTGCCCTT
                    G - C
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK