| Sequence ID | >WENV181416898 |
| Genome ID | OGCL01177004 |
| Phylum/Class | [OGCL] hot springs metagenome; Hot spring water |
| Species | |
| Start position on genome | 334 |
| End posion on genome | 247 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
tacatcataT |
| tRNA gene sequence |
GCCGGGATAGCCTAGCCAGGTAAGGCGCAAGACTGGAAATCTTGTGGAGCTCTGCTCCTC |
| Downstream region at tRNA end position |
gttaaagcaa |
| Secondary structure (Cloverleaf model) | >WENV181416898 Ser GGA
T GTCg gttaaagcaa
G - C
C - G
C - G
G - C
G - C
G - C
A - T T A
T G A C C C A
C G A A | | | | | A
C T C C G C T G G G C
A | | | | T T
G A G G C
G T A G TGGAGCTCTGCTCCTC
C - G
A - T
A - T
G - C
A - T
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |