The detailed information of tRNA gene sequence


Sequence ID>W141150562
Genome IDAXAM01000023
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfosarcina sp. BuS5 [AXAM]
Start position on genome 14841
End posion on genome 14766
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ttttttttct
tRNA gene sequence
GGGCGGGTAGCTCAGTTGGGAGAGCATCGGCCTTACAAGCCGAGGGTCACAGGTTCAAGC
CCTGTTCCGCCTACCA
Downstream region at tRNA end position
tcaaaaaata
Secondary structure (Cloverleaf model)
>W141150562	Val	TAC
                   t      ACCA tcaaaaaata
                     G + T
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     G + T          C G
                    T     T G T C C     A
      T G A        A      | | | | |     A
    T       C T C G       A C A G G     C
    G       | | | |                 T T
    G       G A G C
      G A          A     GGGTC
                    T - A
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK