| Sequence ID | >WENV181618938 |
| Genome ID | OGMC01040248 |
| Phylum/Class | [OGMC] metagenome; Human gut stool |
| Species | |
| Start position on genome | 528 |
| End posion on genome | 453 |
| Amino Acid | fMet |
| Anticodon | CAT |
| Upstream region at tRNA start position |
nttttcttat |
| tRNA gene sequence |
AGCAGGGTGGGGTAGTCTGGTGATCCCGCGGGGCTCATAACCCCGAGATCCCTAGTTCAA |
| Downstream region at tRNA end position |
aattttattt |
| Secondary structure (Cloverleaf model) | >WENV181618938 fMet CAT
t ACtt aattttattt
A - T
G - C
C - G
A - T
G - C
G - C
G - C T A
T G G A T C A
C T G A G | | | | | A
T T G G G C C T A G C
G | | | T T
G T C C C
T G A G AGATC
C - G
G - C
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |