| Sequence ID | >WENV181839175 |
| Genome ID | OGVO01000006 |
| Phylum/Class | [OGVO] freshwater metagenome; freshwater |
| Species | |
| Start position on genome | 23045 |
| End posion on genome | 23120 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
tggaagtaaa |
| tRNA gene sequence |
GCTGGTTTAGCTCAGTTGGTAGAGCAACTGCCTTGTAAGCAGTAGGTCGTCAGTTCGAAT |
| Downstream region at tRNA end position |
ttacaattct |
| Secondary structure (Cloverleaf model) | >WENV181839175 Thr TGT
a ACCA ttacaattct
G - C
C - G
T - A
G - C
G - C
T - A
T - A T A
T C A G C C A
T G A A | | | | G
T C T C G G T C A G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
C - G
T - A
G - C
C - G
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |