| Sequence ID | >WENV182571130 |
| Genome ID | OJFG01000534 |
| Phylum/Class | [OJFG] seawater metagenome; Sea water |
| Species | |
| Start position on genome | 57 |
| End posion on genome | 147 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
ccctgctgcT |
| tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC |
| Downstream region at tRNA end position |
caaacaagct |
| Secondary structure (Cloverleaf model) | >WENV182571130 Ser GCT
T GTtt caaacaagct
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C T C C C A
T G A G | | | | | G
G G T C G G A G G G C
G | | | T T
T A A G C
T G A G TACAGGAGGCAACTTCTGTC
G + T
C - G
T - A
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |