| Sequence ID | >W141277366 |
| Genome ID | JAEN01000014 |
| Phylum/Class | Alphaproteobacteria |
| Species | Paracoccus sp. J39 [JAEN] |
| Start position on genome | 54654 |
| End posion on genome | 54739 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
aatccccggc |
| tRNA gene sequence |
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC |
| Downstream region at tRNA end position |
gatccatgcg |
| Secondary structure (Cloverleaf model) | >W141277366 Leu TAA
c ACCA gatccatgcg
G - C
C - G
G - C
G - C
G - C
C - G
G - C T G
T C G C C C A
T A A G | | | | | G
G G G C G G C G G G C
G | | | T T
T A C G C
A G A GGGGCGCAAGCCTGT
T T
G - C
G - C
G - C
A - T
C C
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |