The detailed information of tRNA gene sequence


Sequence ID>W141289729
Genome IDJARN01000048
Search identical group
Phylum/ClassChloroflexi
SpeciesDehalococcoidia bacterium DscP2 [JARN]
Start position on genome 8012
End posion on genome 8087
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
tattttcagt
tRNA gene sequence
GCCGAGGTAGCTCAGTCGGTAGAGCAGCGGACTGAAAATCCGCGTGTCCCCAGTTCGATT
CTGGGCCTCGGCACCA
Downstream region at tRNA end position
agccgaagtg
Secondary structure (Cloverleaf model)
>W141289729	Phe	GAA
                   t      ACCA agccgaagtg
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T T
                    T     G G G T C     A
      T G A        A      | | | | |     G
    C       C T C G       C C C A G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK