The detailed information of tRNA gene sequence


Sequence ID>C08003514
Genome IDCP001097
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium limicola DSM 245
Start position on genome 1769758
End posion on genome 1769684
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
gctttttatg
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCgc
Downstream region at tRNA end position
agaaggcccc
Secondary structure (Cloverleaf model)
>C08003514	His	GTG
                   g      CCgc agaaggcccc
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK