The detailed information of tRNA gene sequence


Sequence ID>C08003503
Genome IDCP001097
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium limicola DSM 245
Start position on genome 1674926
End posion on genome 1675010
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
agtttgcgaa
tRNA gene sequence
GCCCGAATGGCGGAACTGGTAGACGCACTCGTTTCAGGGACGAGCGCCGCAAGGTGTAGG
AGTTCGAATCTCCTTTCGGGCACCA
Downstream region at tRNA end position
aaaatcttcg
Secondary structure (Cloverleaf model)
>C08003503	Leu	CAG
                   a      ACCA aaaatcttcg
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     A - T          T A
                    T     T C C T C     A
      C A A        G      | | | | |     G
    T       G G C G       A G G A G     C
    G         | | |                 T T
    G       A C G C
      T A G        A     CGCCGCAAGGTGT
                    C - G
                    T - A
                    C - G
                    G - C
                    T - A
                  T       G
                  T       G
                    C A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK