The detailed information of tRNA gene sequence


Sequence ID>C08003490
Genome IDCP001097
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium limicola DSM 245
Start position on genome 210715
End posion on genome 210788
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
ttttcgatag
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTCgg
Downstream region at tRNA end position
attttatgcg
Secondary structure (Cloverleaf model)
>C08003490	Thr	GGT
                   g      TCgg attttatgcg
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK