The detailed information of tRNA gene sequence


Sequence ID>C08003631
Genome IDCP001101
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium phaeobacteroides BS1
Start position on genome 311817
End posion on genome 311890
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
ctatagccag
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTCac
Downstream region at tRNA end position
atgctaatat
Secondary structure (Cloverleaf model)
>C08003631	Thr	GGT
                   g      TCac atgctaatat
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK