The detailed information of tRNA gene sequence


Sequence ID>C08003592
Genome IDCP001099
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobaculum parvum NCIB 8327
Start position on genome 1214369
End posion on genome 1214442
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
gcttcacttt
tRNA gene sequence
GGTGAAGTGGCCGAGTGGCTAGGCAGAGGTCTGCAAAACCTCGTACAGCGGTTCGAATCC
GCTCTTCACCTCCA
Downstream region at tRNA end position
ataaaaaagc
Secondary structure (Cloverleaf model)
>C08003592	Cys	GCA
                   t      TCCA ataaaaaagc
                     G - C
                     G - C
                     T - A
                     G - C
                     A - T
                     A - T
                     G - C          T A
                    T     T C G C C     A
        G A        G      | | | | |     G
      T     G C C G       A G C G G     C
      G       | | |                 T T
      G     A G G C
        C T        A     GTAC
                    G - C
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK