The detailed information of tRNA gene sequence


Sequence ID>C08003607
Genome IDCP001099
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobaculum parvum NCIB 8327
Start position on genome 2083370
End posion on genome 2083295
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
ttgatgacaa
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTCCG
Downstream region at tRNA end position
gctcccgcag
Secondary structure (Cloverleaf model)
>C08003607	Thr	GGT
                   a      TCCG gctcccgcag
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK