The detailed information of tRNA gene sequence


Sequence ID>C08003804
Genome IDCP001100
Search identical group
Phylum/ClassChlorobi
SpeciesChloroherpeton thalassium ATCC 35110
Start position on genome 1779061
End posion on genome 1779136
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
agcaaagatg
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCAc
Downstream region at tRNA end position
agccaagtta
Secondary structure (Cloverleaf model)
>C08003804	His	GTG
                   g      CCAc agccaagtta
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK