The detailed information of tRNA gene sequence


Sequence ID>C08007158
Genome IDCP001108
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris aestuarii DSM 271
Start position on genome 894949
End posion on genome 895023
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
gatttctatg
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCtg
Downstream region at tRNA end position
tgtattgttg
Secondary structure (Cloverleaf model)
>C08007158	His	GTG
                   g      CCtg tgtattgttg
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK