The detailed information of tRNA gene sequence


Sequence ID>C08007150
Genome IDCP001108
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris aestuarii DSM 271
Start position on genome 298341
End posion on genome 298414
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
actggaatag
tRNA gene sequence
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT
CCGATCATCAGCTCag
Downstream region at tRNA end position
gagtatggac
Secondary structure (Cloverleaf model)
>C08007150	Thr	GGT
                   g      TCag gagtatggac
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T A G C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK