The detailed information of tRNA gene sequence


Sequence ID>WENV183234018
Genome IDOLQV01009244
Search identical group
Phylum/Class[OLQV] human gut metagenome; faeces
Species
Start position on genome 299
End posion on genome 374
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
cactgcgatc
tRNA gene sequence
GGGAGCATAGCTCAGCTGGGAGAGCACTTGCCTTACAAGCAAGGGGTCACAGGTTCGAGC
CCTGTTGCTCCCACCA
Downstream region at tRNA end position
aacggcccgg
Secondary structure (Cloverleaf model)
>WENV183234018	Val	TAC
                   c      ACCA aacggcccgg
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C
                     C - G
                     A - T          C G
                    T     T G T C C     A
      C G A        A      | | | | |     G
    T       C T C G       A C A G G     C
    G       | | | |                 T T
    G       G A G C
      G A          A     GGGTC
                    C - G
                    T - A
                    T - A
                    G - C
                    C - G
                  C       A
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK