| Sequence ID | >WENV183458981 |
| Genome ID | OMDN01004142 |
| Phylum/Class | [OMDN] human gut metagenome; feces |
| Species | |
| Start position on genome | 1989 |
| End posion on genome | 1914 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
gacgtgtttt |
| tRNA gene sequence |
GGGAGCATAGCTCAGCTGGGAGAGCACTTGCCTTACAAGCAAGGGGTCACAGGTTCGAGC |
| Downstream region at tRNA end position |
tttggtccgg |
| Secondary structure (Cloverleaf model) | >WENV183458981 Val TAC
t ACCA tttggtccgg
G - C
G - C
G - C
A - T
G - C
C - G
A - T C G
T T G T C C A
C G A A | | | | | G
T C T C G A C A G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
T - A
T - A
G - C
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |