The detailed information of tRNA gene sequence


Sequence ID>WENV183622860
Genome IDOOFW01026249
Search identical group
Phylum/Class[OOFW] marine metagenome; sea ice
Species
Start position on genome 381
End posion on genome 456
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ccactttctg
tRNA gene sequence
GGGCCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGCTGGTTCGAAT
CCAGCACGGCCCACCA
Downstream region at tRNA end position
ttatttagta
Secondary structure (Cloverleaf model)
>WENV183622860	Lys	TTT
                   g      ACCA ttatttagta
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     T - A          T A
                    T     C G A C C     A
      T G A        A      | | | | |     G
    T       C T C G       G C T G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     TGGTC
                    G + T
                    T - A
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK