The detailed information of tRNA gene sequence


Sequence ID>WENV183637065
Genome IDOPGP01000001
Search identical group
Phylum/Class[OPGP] human gut metagenome; Material from the ethmoid
Species
Start position on genome 520042
End posion on genome 520113
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
tcggcgccgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCag
Downstream region at tRNA end position
cctgcgagag
Secondary structure (Cloverleaf model)
>WENV183637065	Gly	CCC
                   c      TCag cctgcgagag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK