The detailed information of tRNA gene sequence


Sequence ID>WENV183718751
Genome IDPDWJ01006335
Search identical group
Phylum/Class[PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J
Species
Start position on genome 9560
End posion on genome 9486
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
cccgcaaaac
tRNA gene sequence
GGCGAGGTAGCTCAGTTGGTTAGAGCGTCGGATTCATAACCCGGAGGTCTCGAGTTCAAT
TCTCGATCTCGCTACtt
Downstream region at tRNA end position
aataatcaag
Secondary structure (Cloverleaf model)
>WENV183718751	Met	CAT
                   c      ACtt aataatcaag
                     G + T
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     G + T          T T
                    T     A G C T C     A
      T G A        A      | | | | |     A
    T       C T C G       T C G A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    T + G
                    C - G
                    G - C
                    G - C
                    A   C
                  T       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK