Sequence ID | >WENV183723917 |
Genome ID | PEHZ01003815 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 400 |
End posion on genome | 316 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgcaacatca |
tRNA gene sequence |
GCCGTCGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCG |
Downstream region at tRNA end position |
aaacaaaagc |
Secondary structure (Cloverleaf model) | >WENV183723917 Leu GAG a ACCA aaacaaaagc G - C C - G C - G G - C T - A C - G G - C T G T C G C T C A T A A G | | | | | G T A G T G G C G A G C G | | | T T G A C A C T A G G TGGCGAAAGCTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |