Sequence ID | >WENV183723944 |
Genome ID | PEHZ01009422 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 4514 |
End posion on genome | 4430 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aggcaagccg |
tRNA gene sequence |
GCCCGAGTGGCGGAATGGTAGACGCGGCGCACTCAAAATGCGCTGTCCTTGCGGGCGTAG |
Downstream region at tRNA end position |
tcggcttata |
Secondary structure (Cloverleaf model) | >WENV183723944 Leu CAA g ACCg tcggcttata G - C C - G C - G C - G G - C A - T G - C T C T T C C C C A T A A G | | | | | G G G G C G A G G G G C G | | | T T T A C G C A G G TGTCCTTGCGGGCGT G - C C - G G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |