Sequence ID | >WENV183723978 |
Genome ID | PEHZ01013814 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 397 |
End posion on genome | 482 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gctacttggc |
tRNA gene sequence |
GGAGGATTCGCCTAGAGGCCTATGGCGCTCGCTTGGAAAGCGGGTTGGGTTCACGCCCTC |
Downstream region at tRNA end position |
caagtccgcc |
Secondary structure (Cloverleaf model) | >WENV183723978 Ser GGA c GCgg caagtccgcc G - C G - C A - T G - C G - C A - T T - A T A T T G C T C A A G A C | | | | | G G T C C G A C G A G C G | | | T T C T G G C C T A G TTGGGTTCACGCCCTC C - G T + G C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |