Sequence ID | >WENV183723995 |
Genome ID | PEHZ01015410 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 707 |
End posion on genome | 622 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtgcccggtt |
tRNA gene sequence |
GGCGAGATCGCATAGTGGACGAGTGCAGCCGCCTTGAAAGCGGCCGAGGGCAACCTCCGT |
Downstream region at tRNA end position |
cggagcctgt |
Secondary structure (Cloverleaf model) | >WENV183723995 Ser TGA t GCCA cggagcctgt G - C G - C C - G G - C A - T G - C A - T T A T C A C C C A T G A C | | | | | G G T A C G G T G G G C G + | | | T T A G T G C C G A A CGAGGGCAACCTCC G - C C - G C - G G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |