Sequence ID | >WENV183724012 |
Genome ID | PEHZ01016472 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 242 |
End posion on genome | 329 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ggcgccccga |
tRNA gene sequence |
GTCCGGGTGGCGGAATTGGTAGACGCGCTAGCTTGAGGTGCTAGTGGCCGATTAAGGCTG |
Downstream region at tRNA end position |
cgggattgct |
Secondary structure (Cloverleaf model) | >WENV183724012 Leu GAG a ACCc cgggattgct G - C T - A C - G C - G G - C G + T G - C T G T T C T C C A T A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C T A G G TGGCCGATTAAGGCTGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |