Sequence ID | >WENV183724022 |
Genome ID | PEHZ01018039 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 154 |
End posion on genome | 71 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tgagcccgat |
tRNA gene sequence |
GCGCGAGTGGCGGAATGGCAGACGCGCTGGCTTCAGGTGCCAGTGTCCCTTGGGACGTGG |
Downstream region at tRNA end position |
cgaataagaa |
Secondary structure (Cloverleaf model) | >WENV183724022 Leu CAG t ACaa cgaataagaa G - C C - G G - C C - G G - C A - T G - C T C T T C T C C A T A A G + | | | | A G G G C G G G A G G C G | | | T T C A C G C A G G TGTCCCTTGGGACGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |