Sequence ID | >WENV170000981 |
Genome ID | AGBJ01000117 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 8875 |
End posion on genome | 8961 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gtaccaaaat |
tRNA gene sequence |
GCCCGGGTGGTGGAATGGTAGACACAGGGGACTTAAAATCCCCCGGTCATTGTGACCGTG |
Downstream region at tRNA end position |
cccaaatatg |
Secondary structure (Cloverleaf model) | >WENV170000981 Leu TAA t ACCA cccaaatatg G + T C - G C - G C - G G - C G - C G + T T G T C G G C C A T A A G | | | | | A G G G T G G C C G G C G | | | T T T A C A C A G A CGGTCATTGTGACCGT G - C G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |