Sequence ID | >WENV170001001 |
Genome ID | AGBJ01000319 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 472 |
End posion on genome | 398 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttttataaga |
tRNA gene sequence |
AGGCGCGTAGCTCAGGGGGAGAGCGCTACCTTGACACGGTAGAGGTCACGGGTTCAAATC |
Downstream region at tRNA end position |
ttaaagatca |
Secondary structure (Cloverleaf model) | >WENV170001001 Val GAC a ACCA ttaaagatca A - T G - C G - C C - G G + T C - G G - C T A T T G C C C A G A A | | | | | A G C T C G A C G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |